Summary for the 101-st Site(A)

PID QueryLength FocusSite TITLE
2624989 215 101 A RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 101-th site HELIX:
REGION: /note="Cytokine-stimulating activity"
DNA_BIND: /note="HMG box 2"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
A:60% G:14% S:11% I:6% P:6% M:2% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
2yrq H (alpha-helix) b (buried) 0.0
3D Complex Information
Predicted Bind Molecules
nucleotide:7
Templates for 3D complexes
nucleotide [tttattattttatattatataaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5jgh_A_1_B_1 5jgh_G_1_H_1 5jgh_J_1_K_1 [aataataaattatataatataaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5jh0_A_1_B_1 [xxxxgatctggcctgtcttacacagtgatacagcccttaacaaaaacccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6oem_J_1_F_1 6oen_J_1_F_1 6oeo_I_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]