|
PID | QueryLength | FocusSite | TITLE |
2624989 | 215 | 86 K | RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1; |
AC/ID | AC:P09429 ID:HMGB1_HUMAN |
Feature Table for 86-th site |
REGION: /note="LPS binding (Lipid A)" COMPBIAS: /note="Basic and acidic residues" REGION: /note="Disordered" REGION: /note="Sufficient for interaction with HAVCR2" CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526" |
Percentages of Amino Acids in Homologous Proteins
![]() |
K:51% R:19% E:7% G:7% S:4% N:3% Q:3% Y:3% A:2% T:2% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
S (bend) | e (exposed) | 85.8 |
Predicted Bind Molecules |
nucleotide:7 |
Templates for 3D complexes |
nucleotide [gttagttggggggtgactgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |