Summary for the 174-th Site(G)
PID QueryLength FocusSite TITLE
2624989 215 174 G RecName: Full=High mobility group protein B1;AltName: Full=High mobility group protein 1; Short=HMG-1;
UniProt Information
AC/IDAC:P09429 ID:HMGB1_HUMAN
Feature Table for 174-th site COMPBIAS: /note="Basic and acidic residues"
REGION: /note="Binding to AGER/RAGE"
REGION: /note="Disordered"
CHAIN: /note="High mobility group protein B1" /id="PRO_0000048526"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
G:36% S:22% V:8% A:6% T:5% C:4% K:4% F:4% Y:4% R:3% E:1% L:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
6hb4 (coil) e (exposed) 64.9
3D Complex Information
Predicted Bind Molecules
nucleotide:8 precipitant:1
Templates for 3D complexes
nucleotide [taacagtcaccccccaacXaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 3tq6_A_1_C_1 [taagttggttatcgggaccggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 4nnu_A_1_C_1 4nnu_B_1_D_1 [ctgtgcagacattcaattgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6hb4_A_1_B_1 6hb4_D_1_E_1 6hb4_G_1_H_1 6hb4_J_1_K_1 [tagcctttctattagctcttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7lbw_A_1_C_1 precipitant [EDO ] 7lbw_A_1_H_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]