#WARNING:no index is registered index "YP_009725306.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725306.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 1-st Site(A)

PID QueryLength FocusSite TITLE
2496219 139 1 A
UniProt Information
AC/IDAC:YP_009725306.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
A:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n0d (coil) e (exposed) 139.3
3D Complex Information
Predicted Bind Molecules
hetero:24 nucleotide:6
Templates for 3D complexes
hetero [92369:R1AB_CVHSA ] 5c8s_A_1_B_1 5c8s_C_1_D_1 5c8t_A_1_B_1 5c8t_C_1_D_1 5c8u_A_1_B_1 5c8u_C_1_D_1 5nfy_E_1_A_1 5nfy_F_1_B_1 5nfy_G_1_D_1 5nfy_H_1_C_1 [68476:R1AB_SARS2 ] 7diy_A_1_B_1 7mc5_B_1_A_1 7mc6_B_1_A_1 [28250:R1AB_SARS2 ] 7egq_G_1_F_1 7egq_O_1_N_1 [92365:R1AB_SARS2 ] 7egq_G_1_H_1 7egq_O_1_P_1 7eiz_F_1_I_1 7n0b_A_1_B_1 7n0c_A_1_B_1 7n0d_A_1_B_1 7n0d_C_1_D_1 7n0d_H_1_I_1 7n0d_J_1_K_1 nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_A_1_C_1 [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_A_1_C_1 [ggggaugugauuuuaauagxxxxxxxx ] 7n0d_A_1_E_1 7n0d_C_1_E_1 7n0d_H_1_L_1 7n0d_J_1_L_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]