#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 202-nd Site(K)

PID QueryLength FocusSite TITLE
1992296 601 202 K
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:79% R:13% Q:8% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
6xez (coil) b (buried) 17.5
3D Complex Information
Predicted Bind Molecules
nucleotide:1 compound:1
Templates for 3D complexes
nucleotide [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_E_1_T_1 compound [JHJ ] 5rma_B_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]