Summary for the 390-th Site(R) |
PID | QueryLength | FocusSite | TITLE |
1992296 | 601 | 390 R |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:38% P:12% S:11% C:9% L:9% V:9% A:8% K:4% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | H (alpha-helix) | e (exposed) | 37.9 |
Predicted Bind Molecules |
homo:1 nucleotide:4 compound:4 |
Templates for 3D complexes |
homo [95432:R1AB_SARS2 ] 7rdx_F_1_E_1 nucleotide [uaaaau ] 7cxn_I_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VVG ] 5rl8_A_1_C_1 [VWJ ] 5rlv_A_1_D_1 [PK4 ] 5rm4_B_1_H_1 [6SU ] 5rmc_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |