Summary for the 176-th Site(L) |
PID | QueryLength | FocusSite | TITLE |
1992296 | 601 | 176 L |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
L:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | S (bend) | b (buried) | 18.5 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_E_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |