#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 337-th Site(R)

PID QueryLength FocusSite TITLE
1992296 601 337 R
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
R:23% K:21% N:16% Y:14% E:13% I:13% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7cxm (coil) e (exposed) 44.3
3D Complex Information
Predicted Bind Molecules
nucleotide:2 compound:1
Templates for 3D complexes
nucleotide [uaaaau ] 7cxn_I_1_G_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_E_1_H_1 compound [NYV ] 5rlk_B_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]