#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 382-nd Site(Y)

PID QueryLength FocusSite TITLE
1992296 601 382 Y
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Y:35% L:17% I:13% H:11% N:10% P:10% A:1% G:1% S:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7cxm H (alpha-helix) b (buried) 11.7
3D Complex Information
Predicted Bind Molecules
nucleotide:1 compound:1
Templates for 3D complexes
nucleotide [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_E_1_H_1 compound [6SU ] 5rmc_B_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]