Summary for the 99-th Site(D)
PID QueryLength FocusSite TITLE
1682730 498 99 D RecName: Full=Interferon regulatory factor 5 ; Short=IRF-5 ;
UniProt Information
AC/IDAC:Q13568 ID:IRF5_HUMAN
Feature Table for 99-th site DNA_BIND: /note="IRF tryptophan pentad repeat"
CHAIN: /note="Interferon regulatory factor 5" /id="PRO_0000154558"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
D:44% E:17% R:13% V:10% M:7% A:5% G:4%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8hcl T (Hbond turn) b (buried) 17.9
3D Complex Information
Predicted Bind Molecules
nucleotide:2
Templates for 3D complexes
nucleotide [tttactttcggtttcttttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7o56_D_1_C_1 [ggtttctcggtctcagttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 8jks_H_1_F_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]