Summary for the 109-th Site(D)
PID QueryLength FocusSite TITLE
1682730 498 109 D RecName: Full=Interferon regulatory factor 5 ; Short=IRF-5 ;
UniProt Information
AC/IDAC:Q13568 ID:IRF5_HUMAN
Feature Table for 109-th site DNA_BIND: /note="IRF tryptophan pentad repeat"
CHAIN: /note="Interferon regulatory factor 5" /id="PRO_0000154558"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
D:44% L:17% N:11% M:11% E:6% K:6% A:1% G:1% S:1%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7rh2 (coil) e (exposed) 68.5
3D Complex Information
Predicted Bind Molecules
nucleotide:6 metal:5
Templates for 3D complexes
nucleotide [gagaagtgaaagtactttcacttctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1if1_C_1_A_1 1if1_D_1_B_1 [aagtgaaagXgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2irf_J_1_B_1 [gctttctcggtttcagttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7jm4_C_1_B_1 7rh2_B_1_E_1 [ggtttctcggtttcagttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 8jkn_C_1_B_1 metal [ZN ] 3qu6_A_1_F_1 3qu6_B_1_O_1 [CL ] 3qu6_A_1_H_1 3qu6_A_1_J_1 3qu6_B_1_P_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]