Summary for the 85-th Site(K)

PID QueryLength FocusSite TITLE
1682730 498 85 K RecName: Full=Interferon regulatory factor 5 ; Short=IRF-5 ;
UniProt Information
AC/IDAC:Q13568 ID:IRF5_HUMAN
Feature Table for 85-th site DNA_BIND: /note="IRF tryptophan pentad repeat"
CHAIN: /note="Interferon regulatory factor 5" /id="PRO_0000154558"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
T:52% K:24% G:13% V:11% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8hcl H (alpha-helix) e (exposed) 34.4
3D Complex Information
Predicted Bind Molecules
nucleotide:1
Templates for 3D complexes
nucleotide [cagaggaatttcccactttcacttctccctttcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2o61_C_1_B_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]