Summary for the 61-st Site(N)
PID QueryLength FocusSite TITLE
1682730 498 61 N RecName: Full=Interferon regulatory factor 5 ; Short=IRF-5 ;
UniProt Information
AC/IDAC:Q13568 ID:IRF5_HUMAN
Feature Table for 61-th site DNA_BIND: /note="IRF tryptophan pentad repeat"
CHAIN: /note="Interferon regulatory factor 5" /id="PRO_0000154558"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
A:57% F:19% N:17% V:7%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8hcl T (Hbond turn) b (buried) 0.9
3D Complex Information
Predicted Bind Molecules
nucleotide:4 metal:2
Templates for 3D complexes
nucleotide [taaatgacataggaaaactgaaagggagaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1t2k_D_1_A_1 [taaatgacatagggaaactgaaagggaaagtgaaagtgggaaattcctctgaatagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2o6g_D_1_A_1 2o6g_E_1_A_1 2o6g_F_1_A_1 metal [CL ] 3qu6_A_1_M_1 3qu6_C_1_U_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]