|
PID | QueryLength | FocusSite | TITLE |
1682730 | 498 | 21 L | RecName: Full=Interferon regulatory factor 5 ; Short=IRF-5 ; |
AC/ID | AC:Q13568 ID:IRF5_HUMAN |
Feature Table for 21-th site |
DNA_BIND: /note="IRF tryptophan pentad repeat" CHAIN: /note="Interferon regulatory factor 5" /id="PRO_0000154558" |
Percentages of Amino Acids in Homologous Proteins
![]() |
L:89% I:6% V:5% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
H (alpha-helix) | b (buried) | 0.0 |
Predicted Bind Molecules |
nucleotide:2 |
Templates for 3D complexes |
nucleotide [gagaagtgaaagtactttcacttctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |