|
PID | QueryLength | FocusSite | TITLE |
1682730 | 498 | 92 C | RecName: Full=Interferon regulatory factor 5 ; Short=IRF-5 ; |
AC/ID | AC:Q13568 ID:IRF5_HUMAN |
Feature Table for 92-th site |
DNA_BIND: /note="IRF tryptophan pentad repeat" CHAIN: /note="Interferon regulatory factor 5" /id="PRO_0000154558" |
Percentages of Amino Acids in Homologous Proteins
![]() |
C:81% S:19% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
H (alpha-helix) | e (exposed) | 44.7 |
Predicted Bind Molecules |
nucleotide:88 |
Templates for 3D complexes |
nucleotide [gagaagtgaaagtactttcacttctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |