Summary for the 85-th Site(K) |
PID | QueryLength | FocusSite | TITLE |
1682730 | 498 | 85 K | RecName: Full=Interferon regulatory factor 5 ; Short=IRF-5 ; |
AC/ID | AC:Q13568 ID:IRF5_HUMAN |
Feature Table for 85-th site |
DNA_BIND: /note="IRF tryptophan pentad repeat" CHAIN: /note="Interferon regulatory factor 5" /id="PRO_0000154558" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
T:52% K:24% G:13% V:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8hcl | H (alpha-helix) | e (exposed) | 34.4 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [cagaggaatttcccactttcacttctccctttcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 2o61_C_1_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |