Summary for the 98-th Site(R)

PID QueryLength FocusSite TITLE
1682730 498 98 R RecName: Full=Interferon regulatory factor 5 ; Short=IRF-5 ;
UniProt Information
AC/IDAC:Q13568 ID:IRF5_HUMAN
Feature Table for 98-th site DNA_BIND: /note="IRF tryptophan pentad repeat"
CHAIN: /note="Interferon regulatory factor 5" /id="PRO_0000154558"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
P:26% R:24% E:19% S:11% N:7% G:7% H:7% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8hcl T (Hbond turn) e (exposed) 76.0
3D Complex Information
Predicted Bind Molecules
homo:1 nucleotide:7
Templates for 3D complexes
homo [28073:IRF3_HUMAN ] 2o6g_C_1_E_1 nucleotide [gctttctcggtttcagttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7jm4_D_1_B_1 7rh2_A_1_E_1 [agctttctcggtttcagttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7oot_A_1_D_1 [xctttctcggtttcagttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7rh2_H_1_F_1 [ggtttctcggtgtcagttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 8jkq_D_1_B_1 8jkq_H_1_F_1 [ggtttctcggtctcagttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 8jks_H_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]