#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 58-th Site(M)

PID QueryLength FocusSite TITLE
151421 527 58 M
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
M:91% L:9% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq (coil) e (exposed) 27.5
3D Complex Information
Predicted Bind Molecules
nucleotide:6 compound:6 precipitant:1
Templates for 3D complexes
nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1 [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_B_1_C_1 [ggggaugugauuuuaauagxxxxxxxx ] 7n0d_B_1_E_1 7n0d_D_1_E_1 7n0d_I_1_L_1 7n0d_K_1_L_1 compound [UX1 ] 5slu_A_1_G_1 [EJQ ] 5slv_A_1_G_1 [LMW ] 5slx_A_1_G_1 [LQP ] 5slz_A_1_G_1 [I8D ] 5sme_A_1_G_1 [LQV ] 5smi_A_1_G_1 precipitant [TLA ] 7mc5_A_1_Q_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]