Summary for the 268-th Site(H) |
PID | QueryLength | FocusSite | TITLE |
151421 | 527 | 268 H |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
H:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | S (bend) | e (exposed) | 45.0 |
Predicted Bind Molecules |
nucleotide:5 compound:2 metal:2 precipitant:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1 [ccccc ] 7n0d_D_1_G_1 7n0d_K_1_N_1 compound [O2M ] 5sky_A_1_G_1 [WKS ] 5smd_A_1_G_1 metal [MG ] 7egq_H_1_HA_1 7n0c_B_1_G_1 precipitant [EDO ] 7mc5_A_1_N_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |