#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 9-th Site(K)

PID QueryLength FocusSite TITLE
151421 527 9 K
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq (coil) e (exposed) 48.1
3D Complex Information
Predicted Bind Molecules
hetero:5 nucleotide:1
Templates for 3D complexes
hetero [30940:R1AB_SARS2 ] 7diy_B_1_A_1 7egq_H_1_G_1 7egq_P_1_O_1 7eiz_I_1_F_1 7n0b_B_1_A_1 nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]