#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 139-th Site(K)

PID QueryLength FocusSite TITLE
151421 527 139 K
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
R:51% K:49% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq E (beta-strand) e (exposed) 46.2
3D Complex Information
Predicted Bind Molecules
hetero:2 nucleotide:1 precipitant:1
Templates for 3D complexes
hetero [100252:R1AB_SARS2 ] 7egq_P_1_I_1 7eiz_I_1_A_1 nucleotide [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_B_1_C_1 precipitant [TLA ] 7mc5_A_1_P_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]