|
PID | QueryLength | FocusSite | TITLE |
151421 | 527 | 187 A |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
A:52% S:29% G:14% C:5% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
S (bend) | e (exposed) | 40.2 |
Predicted Bind Molecules |
nucleotide:5 metal:1 precipitant:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |