#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 145-th Site(Q)

PID QueryLength FocusSite TITLE
151421 527 145 Q
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:94% K:6% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq G (3/10-helix) e (exposed) 42.3
3D Complex Information
Predicted Bind Molecules
homo:4 nucleotide:3
Templates for 3D complexes
homo [92828:R1AB_SARS2 ] 7n0d_B_1_K_1 7n0d_D_1_I_1 7n0d_I_1_D_1 7n0d_K_1_B_1 nucleotide [xxxxxxxxxxxxxxagaagcuauuaaaaucacc ] 7n0b_B_1_D_1 [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_I_1_M_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]