#WARNING:no index is registered index "YP_009725309.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725309.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 13-rd Site(K)

PID QueryLength FocusSite TITLE
151421 527 13 K
UniProt Information
AC/IDAC:YP_009725309.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:56% R:44% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq S (bend) e (exposed) 62.3
3D Complex Information
Predicted Bind Molecules
hetero:1 nucleotide:3 precipitant:2
Templates for 3D complexes
hetero [100764:R1AB_SARS2 ] 7eiz_I_1_A_1 nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1 [ggggaugugauuuuaauagxxxxxxxx ] 7n0d_B_1_E_1 7n0d_I_1_L_1 precipitant [TLA ] 7mc5_A_1_P_1 [EDO ] 7mc5_A_1_W_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]