Summary for the 6-th Site(G) |
PID | QueryLength | FocusSite | TITLE |
151421 | 527 | 6 G |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
G:81% N:19% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | S (bend) | e (exposed) | 48.8 |
Predicted Bind Molecules |
hetero:1 nucleotide:6 precipitant:1 |
Templates for 3D complexes |
hetero [31070:Q1T6X8_CVHSA ] 5nfy_B_1_F_1 nucleotide [xxxxaugugauuuuaauagcuucuxxxxxxxxxxxxxx ] 7n0b_B_1_C_1 [xxxaugugauuuuaauagcuucuuaggaxxxxxxxxx ] 7n0c_B_1_C_1 [ggggaugugauuuuaauagxxxxxxxx ] 7n0d_B_1_E_1 7n0d_D_1_E_1 7n0d_I_1_L_1 7n0d_K_1_L_1 precipitant [TLA ] 7mc5_A_1_Q_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |