#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 593-rd Site(K)

PID QueryLength FocusSite TITLE
1513894 932 593 K
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwk S (bend) e (exposed) 22.6
3D Complex Information
Predicted Bind Molecules
nucleotide:4 compound:1
Templates for 3D complexes
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 7rdz_A_1_G_1 7re2_A_1_F_1 [gcgguaguagcaugcuagggagcag ] 8gw1_A_1_E_1 8gwb_A_1_I_1 compound [GO3 ] 8gy6_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]