|
PID | QueryLength | FocusSite | TITLE |
1513894 | 932 | 544 L |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
L:73% T:15% K:12% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
E (beta-strand) | b (buried) | 16.9 |
Predicted Bind Molecules |
nucleotide:3 |
Templates for 3D complexes |
nucleotide [aaugucugacugcucccuagcaugcuacuaccg ] ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |