#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 911-st Site(N)

PID QueryLength FocusSite TITLE
1513894 932 911 N
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
N:31% D:24% K:9% A:7% Q:7% G:7% H:7% S:6% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwk S (bend) e (exposed) 66.7
3D Complex Information
Predicted Bind Molecules
nucleotide:3
Templates for 3D complexes
nucleotide [xxxxxxxgcacugcguaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7b3c_A_1_E_1 [xxxxxxccccauaacuuaaucucacauagc ] 7ed5_A_1_F_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 8sq9_A_1_G_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]