#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 854-th Site(L)

PID QueryLength FocusSite TITLE
1513894 932 854 L
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
L:35% Y:30% I:15% V:14% A:6% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwk G (3/10-helix) e (exposed) 60.1
3D Complex Information
Predicted Bind Molecules
hetero:37 nucleotide:11 compound:1
Templates for 3D complexes
hetero [28576:R1AB_SARS2 ] 6yyt_A_1_D_1 7c2k_A_1_D_1 7cyq_A_1_D_1 7dok_C_1_F_1 7dte_A_1_D_1 7ed5_A_1_D_1 7egq_A_1_D_1 7egq_I_1_L_1 7eiz_A_1_D_1 7krn_A_1_D_1 7kro_A_1_D_1 7krp_A_1_D_1 7rdx_A_1_D_1 7rdy_A_1_D_1 7rdz_A_1_D_1 7re0_A_1_D_1 7re1_A_1_D_1 7re2_A_1_D_1 7re3_A_1_D_1 7re3_J_1_L_1 7uo4_A_1_D_1 7uo7_A_1_F_1 7uo9_A_1_F_1 7uob_A_1_D_1 7uoe_A_1_D_1 8gwb_A_1_D_1 8gwe_A_1_D_1 8gwf_A_1_D_1 8gwg_A_1_D_1 8gwi_A_1_D_1 8gwk_A_1_D_1 8gwm_A_1_D_1 8gwn_A_1_D_1 8gwo_A_1_D_1 8sq9_A_1_D_1 8sqj_A_1_D_1 8sqk_A_1_D_1 nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_A_1_G_1 [xxxxcaugcuacgcguag ] 6yyt_A_1_E_1 [xxxxxcuacgcagug ] 7b3d_A_1_D_1 7oyg_A_1_D_1 7oyg_F_1_I_1 [xxxxxxxxxgauuaaguuau ] 7bv2_A_1_D_1 [gcuaugug ] 7dfh_A_1_E_1 [agauuaaguuau ] 7doi_A_1_D_1 [cuaagaagcuauuXXXXxxxxxxxxxxxxxxxx ] 7l1f_A_1_D_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagua ] 7ozu_A_1_D_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagug ] 7ozv_A_1_D_1 compound [GO3 ] 8gy6_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]