#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 686-th Site(T)

PID QueryLength FocusSite TITLE
1513894 932 686 T
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
T:68% I:18% V:11% S:3% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwk T (Hbond turn) b (buried) 1.9
3D Complex Information
Predicted Bind Molecules
nucleotide:10
Templates for 3D complexes
nucleotide [gugggcccx ] 6xqb_A_1_F_1 [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_A_1_F_1 [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_A_1_T_1 7egq_I_1_V_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_A_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_A_1_H_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 7uo9_A_1_E_1 8sq9_A_1_G_1 [xxxxxxxxxxxxxxxxgugaugcuucgcguggagaaugacguagcaugcuacgxx ] 7uoe_A_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwn_A_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]