|
PID | QueryLength | FocusSite | TITLE |
1513894 | 932 | 549 S |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
S:59% C:30% Q:12% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
B (beta-bridge) | e (exposed) | 22.7 |
Predicted Bind Molecules |
nucleotide:2 compound:1 |
Templates for 3D complexes |
nucleotide [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |