Summary for the 549-th Site(S) |
PID | QueryLength | FocusSite | TITLE |
1513894 | 932 | 549 S |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:59% C:30% Q:12% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwk | B (beta-bridge) | e (exposed) | 22.7 |
Predicted Bind Molecules |
nucleotide:2 compound:1 |
Templates for 3D complexes |
nucleotide [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 compound [H3U ] 7d4f_D_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |